Transcript: Human NR_104237.1

Homo sapiens solute carrier family 25 member 17 (SLC25A17), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SLC25A17 (10478)
Length:
2184
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104237.1
NBCI Gene record:
SLC25A17 (10478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043912 GTGTTCATCATTGGTGCAGTA pLKO.1 654 3UTR 100% 4.050 5.670 N SLC25A17 n/a
2 TRCN0000422604 CAAACTACAAAGGTATCATTG pLKO_005 472 3UTR 100% 10.800 8.640 N SLC25A17 n/a
3 TRCN0000043909 CGATGAAGGAATCTCGGCTTT pLKO.1 515 3UTR 100% 4.050 3.240 N SLC25A17 n/a
4 TRCN0000043908 GCTCTCATGTTCCTTGTTTAT pLKO.1 885 3UTR 100% 13.200 9.240 N SLC25A17 n/a
5 TRCN0000043910 CGTCATAGACTAAACCCAGAA pLKO.1 741 3UTR 100% 4.050 2.835 N SLC25A17 n/a
6 TRCN0000423460 ATGAAAGTTTGTGAGTGTTTA pLKO_005 1216 3UTR 100% 13.200 7.920 N SLC25A17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02449 pDONR223 100% 35.3% None (many diffs) n/a
2 ccsbBroad304_02449 pLX_304 0% 35.3% V5 (many diffs) n/a
3 TRCN0000465602 ACCCGAAAACACTAATTGTTGGCA pLX_317 34.4% 35.3% V5 (many diffs) n/a
Download CSV