Transcript: Human NR_104249.2

Homo sapiens ZXD family zinc finger C (ZXDC), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZXDC (79364)
Length:
3557
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104249.2
NBCI Gene record:
ZXDC (79364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245357 AGAAGTTCACTACGGTCTATA pLKO_005 766 3UTR 100% 13.200 18.480 N ZXDC n/a
2 TRCN0000245359 GTGCAGCAAGCAGTATGATAA pLKO_005 1028 3UTR 100% 13.200 18.480 N ZXDC n/a
3 TRCN0000245358 CGGCTGTGAGAAGACATTTAT pLKO_005 932 3UTR 100% 15.000 10.500 N ZXDC n/a
4 TRCN0000245361 GCCCTCTTCCCAGACTAAATT pLKO_005 3390 3UTR 100% 15.000 10.500 N ZXDC n/a
5 TRCN0000245360 TGACGATGACCGGAGGTTTAC pLKO_005 1172 3UTR 100% 10.800 7.560 N ZXDC n/a
6 TRCN0000117793 CCTCACAGTCTACTCAGAGAA pLKO.1 2422 3UTR 100% 4.950 3.465 N ZXDC n/a
7 TRCN0000117796 GCAGTCTGTACATTCACTCTA pLKO.1 1324 3UTR 100% 4.950 3.465 N ZXDC n/a
8 TRCN0000117794 CCTGCTAATAATAGCTCCCTA pLKO.1 1686 3UTR 100% 2.640 1.848 N ZXDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12561 pDONR223 100% 32.3% None (many diffs) n/a
2 ccsbBroad304_12561 pLX_304 0% 32.3% V5 (many diffs) n/a
3 TRCN0000466658 GCCTGGATCCAGAGTTGCCCCGTC pLX_317 38.4% 32.3% V5 (many diffs) n/a
Download CSV