Transcript: Human NR_104255.2

Homo sapiens autophagy related 9A (ATG9A), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ATG9A (79065)
Length:
3711
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104255.2
NBCI Gene record:
ATG9A (79065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148385 CTTTACGTCTATCCAGTCCTT pLKO.1 1936 3UTR 100% 2.640 3.696 N ATG9A n/a
2 TRCN0000244084 AGCCTGCATGCCCTCTATATG pLKO_005 2243 3UTR 100% 13.200 10.560 N ATG9A n/a
3 TRCN0000244081 AGTCACCTTGGCACCATATTG pLKO_005 284 3UTR 100% 13.200 9.240 N ATG9A n/a
4 TRCN0000244080 GACCGTGTGCAGGTCCTTTAT pLKO_005 1437 3UTR 100% 13.200 9.240 N ATG9A n/a
5 TRCN0000244082 GTGGACTATGACATCCTATTT pLKO_005 442 3UTR 100% 13.200 9.240 N ATG9A n/a
6 TRCN0000148400 CGTCTATCCAGTCCTTACAAT pLKO.1 1941 3UTR 100% 5.625 3.938 N ATG9A n/a
7 TRCN0000244083 TGTAGGAGCAGGATGGAAATA pLKO_005 3308 3UTR 100% 13.200 7.920 N ATG9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471062 AGCTATAACGCCGGTCCCCTTAAC pLX_317 24.3% 42.4% V5 (many diffs) n/a
2 ccsbBroadEn_12539 pDONR223 100% 39.8% None (many diffs) n/a
3 ccsbBroad304_12539 pLX_304 0% 39.8% V5 (many diffs) n/a
4 TRCN0000481101 AGGGAACGCGCGGTGGCAGAGAAC pLX_317 25% 39.8% V5 (many diffs) n/a
Download CSV