Transcript: Mouse NR_104374.1

Mus musculus F-box protein 44 (Fbxo44), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Fbxo44 (230903)
Length:
1656
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104374.1
NBCI Gene record:
Fbxo44 (230903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087536 CCCGGTGATGATTCAGCAGAA pLKO.1 665 3UTR 100% 4.050 5.670 N Fbxo44 n/a
2 TRCN0000087534 GCTGGAACTGTTCATCCACAT pLKO.1 125 3UTR 100% 4.050 5.670 N Fbxo44 n/a
3 TRCN0000087537 CGATGAATGGAAGGTAGAGGA pLKO.1 386 3UTR 100% 2.640 3.696 N Fbxo44 n/a
4 TRCN0000087535 CCTTGTGCTGAAGAGGGATTT pLKO.1 336 3UTR 100% 10.800 7.560 N Fbxo44 n/a
5 TRCN0000073324 CCCAATGACCAGGTCAAGAAA pLKO.1 435 3UTR 100% 5.625 3.938 N FBXO44 n/a
6 TRCN0000420236 CGTCCGCTACATCTGGTTTCA pLKO_005 824 3UTR 100% 4.950 3.465 N FBXO44 n/a
7 TRCN0000087533 GCTTGCCTAGACCTGTTTCTA pLKO.1 1171 3UTR 100% 5.625 3.375 N Fbxo44 n/a
8 TRCN0000073327 AGGTCAAGAAATACTTCGTTA pLKO.1 445 3UTR 100% 4.950 6.930 N FBXO44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04604 pDONR223 100% 35.9% None (many diffs) n/a
2 ccsbBroad304_04604 pLX_304 0% 35.9% V5 (many diffs) n/a
3 TRCN0000467327 ATAAGTGAACCAGAGCAAGCGTTC pLX_317 58.2% 35.9% V5 (many diffs) n/a
Download CSV