Transcript: Human NR_104428.2

Homo sapiens protamine 2 (PRM2), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PRM2 (5620)
Length:
595
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104428.2
NBCI Gene record:
PRM2 (5620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104428.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195797 CCAGGAAGAGAACATGCAGAA pLKO.1 391 3UTR 100% 4.050 2.835 N PRM2 n/a
2 TRCN0000184493 GAGAACATGCAGAAGGCACTA pLKO.1 398 3UTR 100% 4.050 2.835 N PRM2 n/a
3 TRCN0000122505 CAGTTGCATGGGCAAGAGCAA pLKO.1 168 3UTR 100% 2.640 1.848 N PRM2 n/a
4 TRCN0000184521 GAACCAGGAAGAGAACATGCA pLKO.1 388 3UTR 100% 2.640 1.848 N PRM2 n/a
5 TRCN0000122626 GAGGTCTACGAGAGGACCCAT pLKO.1 234 3UTR 100% 0.880 0.616 N PRM2 n/a
6 TRCN0000184320 GAAGAGAACATGCAGAAGGCA pLKO.1 395 3UTR 100% 0.750 0.525 N PRM2 n/a
7 TRCN0000184415 GCAGAACCAGGAAGAGAACAT pLKO.1 385 3UTR 100% 4.950 2.970 N PRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104428.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01296 pDONR223 100% 51.4% None 1_110del;417_595del n/a
2 ccsbBroad304_01296 pLX_304 0% 51.4% V5 1_110del;417_595del n/a
3 TRCN0000472014 CAAATCTATAATCTGGGATGACCC pLX_317 100% 51.4% V5 1_110del;417_595del n/a
Download CSV