Transcript: Human NR_104444.2

Homo sapiens class II major histocompatibility complex transactivator (CIITA), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
CIITA (4261)
Length:
14251
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104444.2
NBCI Gene record:
CIITA (4261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019072 GCTCAGGCTAAGCTTGTACAA pLKO.1 1457 3UTR 100% 4.950 6.930 N CIITA n/a
2 TRCN0000019073 GCTTATGCCAATATCGCGGAA pLKO.1 409 3UTR 100% 2.160 3.024 N CIITA n/a
3 TRCN0000230865 AGGGCCTGAGCAAGGACATTT pLKO_005 464 3UTR 100% 13.200 9.240 N CIITA n/a
4 TRCN0000218883 TCAGGCTAAGCTTGTACAATA pLKO_005 1459 3UTR 100% 13.200 9.240 N CIITA n/a
5 TRCN0000230867 ACAGCTAATGGGACACTAATG pLKO_005 2614 3UTR 100% 10.800 7.560 N CIITA n/a
6 TRCN0000230864 GGCTACCTGGAGCTTCTTAAC pLKO_005 226 3UTR 100% 10.800 7.560 N CIITA n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2347 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 4582 3UTR 100% 4.950 2.475 Y LOC400464 n/a
9 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 6403 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2347 3UTR 100% 5.625 2.813 Y EID2B n/a
11 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3564 3UTR 100% 4.950 2.475 Y Cstad n/a
12 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4489 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 1.2% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 1.2% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 1.2% V5 (many diffs) n/a
Download CSV