Transcript: Human NR_104597.1

Homo sapiens PTTG1 interacting protein (PTTG1IP), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PTTG1IP (754)
Length:
2734
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104597.1
NBCI Gene record:
PTTG1IP (754)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104597.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166637 CCCAGTTCTTCAGGCTGATTT pLKO.1 2290 3UTR 100% 13.200 9.240 N PTTG1IP n/a
2 TRCN0000280589 CCCAGTTCTTCAGGCTGATTT pLKO_005 2290 3UTR 100% 13.200 9.240 N PTTG1IP n/a
3 TRCN0000159333 GAAGACAAGACATGATGAAAT pLKO.1 640 3UTR 100% 13.200 9.240 N PTTG1IP n/a
4 TRCN0000159697 GAGATGAAGACAAGACATGAT pLKO.1 635 3UTR 100% 4.950 3.465 N PTTG1IP n/a
5 TRCN0000161605 GCAGAGATGAAGACAAGACAT pLKO.1 632 3UTR 100% 4.950 3.465 N PTTG1IP n/a
6 TRCN0000280588 GCAGAGATGAAGACAAGACAT pLKO_005 632 3UTR 100% 4.950 3.465 N PTTG1IP n/a
7 TRCN0000160063 CCACAAAGAATAGAACCTGTA pLKO.1 2269 3UTR 100% 4.050 2.835 N PTTG1IP n/a
8 TRCN0000280586 CCACAAAGAATAGAACCTGTA pLKO_005 2269 3UTR 100% 4.050 2.835 N PTTG1IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104597.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15370 pDONR223 0% 15.1% None (many diffs) n/a
2 ccsbBroad304_15370 pLX_304 0% 15.1% V5 (many diffs) n/a
Download CSV