Transcript: Human NR_104627.1

Homo sapiens solute carrier family 35 member D2 (SLC35D2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
SLC35D2 (11046)
Length:
2814
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104627.1
NBCI Gene record:
SLC35D2 (11046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044452 CGTTGCCTACATTGGGATATT pLKO.1 916 3UTR 100% 13.200 18.480 N SLC35D2 n/a
2 TRCN0000044448 GCCACCATAATGATACTATAT pLKO.1 275 3UTR 100% 13.200 10.560 N SLC35D2 n/a
3 TRCN0000415219 ACGGTTCTGTGCAGCTATTAC pLKO_005 848 3UTR 100% 13.200 9.240 N SLC35D2 n/a
4 TRCN0000044450 CCTCAGTGTCTTTGCCATTAT pLKO.1 520 3UTR 100% 13.200 9.240 N SLC35D2 n/a
5 TRCN0000427761 GGATTATCAAGCACAAGTAAA pLKO_005 398 3UTR 100% 13.200 9.240 N SLC35D2 n/a
6 TRCN0000044451 CCAATGGAAGAATGTTGTGTT pLKO.1 775 3UTR 100% 4.950 3.465 N SLC35D2 n/a
7 TRCN0000044449 GCCATCAAGAATGTATCCGTT pLKO.1 899 3UTR 100% 2.640 1.848 N SLC35D2 n/a
8 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 1522 3UTR 100% 4.950 2.475 Y OR11A1 n/a
9 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 1522 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02606 pDONR223 100% 35.9% None 1_76del;1088_2814del n/a
2 ccsbBroad304_02606 pLX_304 0% 35.9% V5 1_76del;1088_2814del n/a
3 TRCN0000476320 GTTAGAAGACCTGCGACGCTAGGT pLX_317 38.2% 35.9% V5 1_76del;1088_2814del n/a
Download CSV