Transcript: Human NR_106740.1

Homo sapiens microRNA 6125 (MIR6125), microRNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
MIR6125 (102465133)
Length:
96
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_106740.1
NBCI Gene record:
MIR6125 (102465133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_106740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_106740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15686 pDONR223 0% 5.2% None 1_56del;96_97ins665 n/a
2 ccsbBroad304_15686 pLX_304 0% 5.2% V5 1_56del;96_97ins665 n/a
3 TRCN0000474200 TGCGCAGACGAGACGCCTTTAGAA pLX_317 64.6% 5.2% V5 1_56del;96_97ins665 n/a
4 ccsbBroadEn_07520 pDONR223 100% 1.3% None 1_56del;96_97ins2816 n/a
5 ccsbBroad304_07520 pLX_304 0% 1.3% V5 1_56del;96_97ins2816 n/a
6 TRCN0000469190 GCCTTGCTGAGTAACATATGGGAT pLX_317 13% 1.3% V5 1_56del;96_97ins2816 n/a
7 TRCN0000489023 GGCGGAGTGAACTATACATGGATC pLX_317 10.5% 1.3% V5 (not translated due to prior stop codon) 1_56del;96_97ins2816 n/a
8 TRCN0000488082 AGTGACAACCTCGTTTCGCGTGAG pLX_317 10.8% 1.3% V5 1_56del;96_97ins2817 n/a
Download CSV