Construct: ORF TRCN0000469190
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018248.1_s317c1
- Derived from:
- ccsbBroadEn_07520
- DNA Barcode:
- GCCTTGCTGAGTAACATATGGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP15 (9958)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469190
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_006313.3 | 99.9% | 99.8% | 2153C>T;2214T>C |
| 2 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001252078.2 | 96.9% | 96.9% | 682_768del;2240C>T;2301T>C |
| 3 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351159.2 | 84.6% | 84.6% | (many diffs) |
| 4 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351160.2 | 76.8% | 76% | (many diffs) |
| 5 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351163.2 | 67.9% | 67.9% | 0_1ins912;1241C>T;1302T>C |
| 6 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351164.2 | 67.9% | 67.9% | 0_1ins912;1241C>T;1302T>C |
| 7 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351165.2 | 67.9% | 67.9% | 0_1ins912;1241C>T;1302T>C |
| 8 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351166.2 | 67.9% | 67.9% | 0_1ins912;1241C>T;1302T>C |
| 9 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001252079.1 | 24.2% | 23.9% | (many diffs) |
| 10 | human | 9958 | USP15 | ubiquitin specific peptidas... | NR_147081.2 | 19.1% | (many diffs) | |
| 11 | human | 9958 | USP15 | ubiquitin specific peptidas... | NR_147078.2 | 19% | (many diffs) | |
| 12 | human | 9958 | USP15 | ubiquitin specific peptidas... | NR_147079.2 | 19% | (many diffs) | |
| 13 | human | 9958 | USP15 | ubiquitin specific peptidas... | NR_147082.2 | 18.9% | (many diffs) | |
| 14 | human | 9958 | USP15 | ubiquitin specific peptidas... | NR_147080.2 | 18.7% | (many diffs) | |
| 15 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351161.2 | 12.6% | 12.1% | (many diffs) |
| 16 | human | 9958 | USP15 | ubiquitin specific peptidas... | NM_001351162.1 | 8.3% | 7.9% | (many diffs) |
| 17 | human | 102465133 | MIR6125 | microRNA 6125 | NR_106740.1 | 1.3% | 1_56del;96_97ins2816 | |
| 18 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | NM_001301628.1 | 90.1% | 97.5% | (many diffs) |
| 19 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | NM_027604.4 | 87.5% | 94.6% | (many diffs) |
| 20 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | XM_006513225.3 | 68.7% | 74.2% | (many diffs) |
| 21 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | XM_006513226.3 | 68.4% | 73.8% | (many diffs) |
| 22 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | XM_006513227.3 | 63.9% | 69.4% | (many diffs) |
| 23 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | XR_380365.3 | 27.6% | (many diffs) | |
| 24 | mouse | 14479 | Usp15 | ubiquitin specific peptidas... | XM_006513228.3 | 25.1% | 23.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2925
- ORF length:
- 2856
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggaaggc ggagcggcgg atctggacac ccagcggtct gacatcgcga 121 cgctgctcaa aacctcgctc cggaaagggg acacctggta cctagtcgat agtcgctggt 181 tcaaacagtg gaaaaaatat gttggctttg acagttggga caaataccag atgggagatc 241 aaaatgtgta tcctggaccc attgataact ctggacttct caaagatggt gatgcccagt 301 cacttaagga acaccttatt gatgaattgg attacatact gttgccaact gaaggttgga 361 ataaacttgt cagctggtac acattgatgg aaggtcaaga gccaatagca cgaaaggtgg 421 ttgaacaggg tatgtttgta aagcactgca aagtagaagt atatctcaca gaattgaagc 481 tatgtgaaaa tggaaacatg aataatgttg taactcgaag atttagcaaa gctgacacaa 541 tagatacaat tgaaaaggaa ataagaaaaa tcttcagtat tccagatgaa aaggagacca 601 gattgtggaa caaatacatg agtaacacat ttgaaccact gaataaacca gacagcacca 661 ttcaggatgc tggtttatac caaggacagg tattagtgat agaacagaaa aatgaagatg 721 gaacatggcc aaggggtcct tctactccta atgtgaaaaa ctcaaattac tgtcttccat 781 catataccgc ttataagaac tatgattatt cggaacctgg aagaaacaat gaacagccag 841 gcctctgtgg cctaagtaac ttgggaaata cgtgtttcat gaactcagct attcagtgtt 901 tgagcaacac acctccactt actgagtatt tcctcaatga taagtatcaa gaagaactga 961 attttgacaa tcccttagga atgagaggtg aaatagctaa atcttatgcc gaactgatca 1021 agcaaatgtg gtctggaaag tttagctacg tcaccccaag agcctttaag acacaggtag 1081 gacgttttgc acctcagttc tctggatatc agcagcaaga ctgtcaagaa ctgttagctt 1141 tcctattaga tggattacat gaggatttga atagaattag gaaaaaacca tatatacaat 1201 taaaagatgc agatggaagg ccagataagg tggttgccga agaagcctgg gaaaaccatt 1261 taaaacgaaa tgattctatc atagtagata tatttcatgg ccttttcaaa tcaactttag 1321 tttgtcctga gtgtgctaag atttcagtaa catttgatcc tttttgttac ttgacacttc 1381 cattgcccat gaaaaaagaa cgcaccttgg aagtttactt agttagaatg gatccactta 1441 ccaaacctat gcagtacaaa gtggttgtcc ccaaaattgg aaacatatta gatctttgta 1501 cagcattgtc tgctttgtca ggaatacctg cagataagat gatagttact gatatataca 1561 atcatagatt tcacagaata ttcgctatgg atgaaaacct tagtagtatt atggaacggg 1621 atgatattta tgtgtttgaa attaacatca ataggacaga agatacagag cacgtgatta 1681 ttcctgtttg cctaagagaa aaattcagac actcgagtta tacccaccat actggttctt 1741 cactttttgg tcagcccttt cttatggctg taccacgaaa caatactgaa gacaaacttt 1801 ataatctcct gctcttgaga atgtgccgat atgtcaaaat atctactgaa actgaagaaa 1861 ctgaaggatc cctacactgc tgtaaggacc aaaatattaa tgggaatggc ccaaatggca 1921 tacatgaaga aggctcacca agtgaaatgg aaacagatga gccagatgat gaatccagcc 1981 aggatcaaga acttccctca gagaatgaaa acagtcagtc tgaagattca gttggaggag 2041 ataatgattc tgaaaatgga ttatgtactg aggatacttg caaaggtcaa ctcacgggac 2101 acaaaaaacg attgtttaca ttccagttca acaacttagg caatactgat atcaactaca 2161 tcaaagatga taccaggcat ataagatttg atgataggca gcttaggcta gatgaaagat 2221 tttttcttgc tttggattgg gatcctgatt tgaaaaaaag atattttgat gaaaatgctg 2281 ccgaggactt tgaaaaacat gaaagtgtgg agtataaacc tcctaaaaaa ccctttgtga 2341 aattaaaaga ttgcattgaa ctttttacaa caaaagaaaa gctaggtgct gaagatccct 2401 ggtattgtcc gaattgtaaa gaacatcagc aagccacaaa gaaattggat ttatggtccc 2461 tgcctccagt acttgtagta catctcaagc gattttctta cagtcgatac atgagagaca 2521 agttggatac cttagttgat tttcctatca atgacttgGA TATGTCGGAA TTCTTAATTA 2581 ATCCAAATGC AGGTCCTTGC CGCTATAATC TGATTGCTGT TTCCAACCAC TATGGAGGGA 2641 TGGGAGGAGG ACACTATACT GCTTTTGCAA AAAATAAAGA TGATGGAAAA TGGTACTATT 2701 TTGATGACAG TAGTGTCTCC ACTGCATCTG AAGACCAAAT TGTGTCCAAA GCAGCATATG 2761 TACTCTTCTA CCAGAGACAA GACACTTTCA GTGGAACTGG CTTTTTTCCT CTTGACCGAG 2821 AAACTAAAGG TGCTTCAGCT GCCACTGGCA TCCCATTAGA AAGTGATGAA GATAGCAATG 2881 ATAATGACAA TGATATAGAA AATGAAAACT GTATGCACAC TAACTTGCCA ACTTTCTTGT 2941 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 3001 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 3061 GAAAGGACGA GCCTTGCTGA GTAACATATG GGATACGCGT TAAGTCgaca atcaacctct 3121 ggattacaaa atttgtgaaa gatt