Transcript: Human NR_110005.1

Homo sapiens LDL receptor related protein associated protein 1 (LRPAP1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
LRPAP1 (4043)
Length:
10414
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110005.1
NBCI Gene record:
LRPAP1 (4043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053338 GACCGAAGAAATCCACGAGAA pLKO.1 548 3UTR 100% 4.050 2.835 N LRPAP1 n/a
2 TRCN0000300523 GACCGAAGAAATCCACGAGAA pLKO_005 548 3UTR 100% 4.050 2.835 N LRPAP1 n/a
3 TRCN0000053340 GAGACTCATACGCAACCTCAA pLKO.1 290 3UTR 100% 4.050 2.835 N LRPAP1 n/a
4 TRCN0000300596 GAGACTCATACGCAACCTCAA pLKO_005 290 3UTR 100% 4.050 2.835 N LRPAP1 n/a
5 TRCN0000053339 CGCCTGGAAGAAACTAAAGCT pLKO.1 236 3UTR 100% 3.000 2.100 N LRPAP1 n/a
6 TRCN0000053341 GCTGGGCTACACGGTGAAGAA pLKO.1 962 3UTR 100% 1.650 1.155 N LRPAP1 n/a
7 TRCN0000300598 GCTGGGCTACACGGTGAAGAA pLKO_005 962 3UTR 100% 1.650 1.155 N LRPAP1 n/a
8 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 5725 3UTR 100% 4.950 2.475 Y CCDC30 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 9428 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9637 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9637 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00949 pDONR223 100% 9.2% None (many diffs) n/a
2 ccsbBroad304_00949 pLX_304 0% 9.2% V5 (many diffs) n/a
3 TRCN0000477200 TTGATACTAAGTGCATACAAACCA pLX_317 21% 9.2% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% .6% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% .6% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .6% V5 (many diffs) n/a
Download CSV