Transcript: Human NR_110129.2

Homo sapiens zinc finger protein 276 (ZNF276), transcript variant d, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF276 (92822)
Length:
4596
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110129.2
NBCI Gene record:
ZNF276 (92822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017765 CCACCATCTACAAGTGTCCTT pLKO.1 1364 3UTR 100% 2.640 2.112 N ZNF276 n/a
2 TRCN0000244379 CTGGACATCTCTGCCTATTAT pLKO_005 3255 3UTR 100% 15.000 10.500 N ZNF276 n/a
3 TRCN0000244277 ACACAGAGGTGCGGAACTATA pLKO_005 1541 3UTR 100% 13.200 9.240 N ZNF276 n/a
4 TRCN0000244380 CTCTGGTAAGAAGAGTGAAAG pLKO_005 1245 3UTR 100% 10.800 7.560 N ZNF276 n/a
5 TRCN0000244378 TCAAGTGGCCATGGGACAAAG pLKO_005 880 3UTR 100% 10.800 7.560 N ZNF276 n/a
6 TRCN0000280643 CCACGACTACACCATGGATAC pLKO_005 815 3UTR 100% 6.000 4.200 N ZNF276 n/a
7 TRCN0000017764 CCATCTTCAACCTCGGATGAT pLKO.1 1134 3UTR 100% 4.950 3.465 N ZNF276 n/a
8 TRCN0000017767 CCTTTGAGCCTTACCCAGAAA pLKO.1 1217 3UTR 100% 4.950 3.465 N ZNF276 n/a
9 TRCN0000017763 CGGCATGAAGAAGCACATCAA pLKO.1 1419 3UTR 100% 4.950 3.465 N ZNF276 n/a
10 TRCN0000017766 CCAAGAAGTCTGAAGAACCAA pLKO.1 1274 3UTR 100% 3.000 2.100 N ZNF276 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09351 pDONR223 100% 34.2% None (many diffs) n/a
2 ccsbBroad304_09351 pLX_304 0% 34.2% V5 (many diffs) n/a
3 TRCN0000470299 CTAGGAGCTGCGTTGACTGCGTTT pLX_317 23.8% 34.2% V5 (many diffs) n/a
4 ccsbBroadEn_12982 pDONR223 100% 23.4% None (many diffs) n/a
5 ccsbBroad304_12982 pLX_304 0% 23.4% V5 (many diffs) n/a
6 TRCN0000491426 GCCGACGTGCCGGACTAACATATT pLX_317 28.2% 23.4% V5 (many diffs) n/a
Download CSV