Transcript: Human NR_110317.1

Homo sapiens zinc finger CCHC-type containing 7 (ZCCHC7), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZCCHC7 (84186)
Length:
2070
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110317.1
NBCI Gene record:
ZCCHC7 (84186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419048 ATATCCATGGAGATCTCAATT pLKO_005 1322 3UTR 100% 13.200 18.480 N ZCCHC7 n/a
2 TRCN0000033989 GCGGTACTATTCAGCCAACAA pLKO.1 238 3UTR 100% 4.950 6.930 N ZCCHC7 n/a
3 TRCN0000033992 GTCTCCAGTATCTCCATTCAT pLKO.1 655 3UTR 100% 5.625 4.500 N ZCCHC7 n/a
4 TRCN0000417576 AGATAGCTAATAACCGAACAC pLKO_005 201 3UTR 100% 4.050 3.240 N ZCCHC7 n/a
5 TRCN0000421935 TACTTTGGAAAGGACAATAAC pLKO_005 1597 3UTR 100% 13.200 9.240 N ZCCHC7 n/a
6 TRCN0000432864 AGAAGCCTTCTAAGCCCTTTC pLKO_005 1008 3UTR 100% 6.000 4.200 N ZCCHC7 n/a
7 TRCN0000033990 CCACACGTCAAGAGAAGACAA pLKO.1 1045 3UTR 100% 4.950 3.465 N ZCCHC7 n/a
8 TRCN0000418762 GGCCATTATGGACACGAATGT pLKO_005 611 3UTR 100% 4.950 3.465 N ZCCHC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10214 pDONR223 100% 42.6% None (many diffs) n/a
2 ccsbBroad304_10214 pLX_304 0% 42.6% V5 (many diffs) n/a
3 TRCN0000469258 CCCTGCAGGCCGTATCTATACCTG pLX_317 24.9% 42.6% V5 (many diffs) n/a
4 ccsbBroadEn_12789 pDONR223 100% 15.5% None (many diffs) n/a
5 ccsbBroad304_12789 pLX_304 0% 15.5% V5 (many diffs) n/a
6 TRCN0000472866 AGCCTCCCCAACCATTTCCGTCCC pLX_317 20.9% 15.5% V5 (many diffs) n/a
Download CSV