Transcript: Mouse NR_110342.1

Mus musculus glutathione peroxidase 4 (Gpx4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gpx4 (625249)
Length:
894
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110342.1
NBCI Gene record:
Gpx4 (625249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235005 ACAGCAAGATCTGTGTAAATG pLKO_005 453 3UTR 100% 13.200 9.240 N Gpx4 n/a
2 TRCN0000235006 ATGCCATCAAATGGAACTTTA pLKO_005 540 3UTR 100% 13.200 9.240 N Gpx4 n/a
3 TRCN0000076552 GCCAGGAAGTAATCAAGAAAT pLKO.1 391 3UTR 100% 13.200 9.240 N Gpx4 n/a
4 TRCN0000235003 GCCAGGAAGTAATCAAGAAAT pLKO_005 391 3UTR 100% 13.200 9.240 N Gpx4 n/a
5 TRCN0000235004 CCGGCTACAACGTCAAGTTTG pLKO_005 426 3UTR 100% 10.800 7.560 N Gpx4 n/a
6 TRCN0000076549 CCCACTGTGGAAATGGATGAA pLKO.1 487 3UTR 100% 4.950 3.465 N Gpx4 n/a
7 TRCN0000076548 CTCATGAAGGTCTGCCTGAAA pLKO.1 731 3UTR 100% 4.950 3.465 N Gpx4 n/a
8 TRCN0000076551 CAAATGGAACTTTACCAAGTT pLKO.1 547 3UTR 100% 0.495 0.297 N Gpx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10859 pDONR223 100% 20.4% None (many diffs) n/a
2 ccsbBroad304_10859 pLX_304 0% 20.4% V5 (many diffs) n/a
3 TRCN0000479656 AGTCCCTATTAAAGCTTCGGTACG pLX_317 100% 20.4% V5 (many diffs) n/a
Download CSV