Transcript: Human NR_110375.1

Homo sapiens TNF and HNRNPL related immunoregulatory long non-coding RNA (THRIL), long non-coding RNA.

Source:
NCBI, updated 2019-01-06
Taxon:
Homo sapiens (human)
Gene:
THRIL (102659353)
Length:
1981
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110375.1
NBCI Gene record:
THRIL (102659353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 11% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 11% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 11% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 9.5% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 9.5% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 9.5% V5 (many diffs) n/a
7 ccsbBroadEn_15487 pDONR223 0% 8.1% None (many diffs) n/a
8 ccsbBroad304_15487 pLX_304 0% 8.1% V5 (many diffs) n/a
9 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 8.1% V5 (many diffs) n/a
Download CSV