Transcript: Human NR_110697.1

Homo sapiens semaphorin 3B (SEMA3B), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SEMA3B (7869)
Length:
1748
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110697.1
NBCI Gene record:
SEMA3B (7869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222103 GCCAATTACACCTTCACTCAA pLKO.1 447 3UTR 100% 4.950 6.930 N SEMA3B n/a
2 TRCN0000222106 CTTCAGTTCCACCAAGGACTT pLKO.1 332 3UTR 100% 4.050 3.240 N SEMA3B n/a
3 TRCN0000378985 CTGTCACCAGCATGCAAATTT pLKO_005 631 3UTR 100% 15.000 10.500 N SEMA3B n/a
4 TRCN0000222105 CCTACAAGTTGGAGCCAATTA pLKO.1 434 3UTR 100% 13.200 9.240 N SEMA3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11245 pDONR223 100% 50.1% None (many diffs) n/a
2 ccsbBroad304_11245 pLX_304 0% 50.1% V5 (many diffs) n/a
3 ccsbBroadEn_01837 pDONR223 100% 43.9% None (many diffs) n/a
4 ccsbBroad304_01837 pLX_304 0% 43.9% V5 (many diffs) n/a
Download CSV