Transcript: Mouse NR_110976.1

Mus musculus testis specific 10 (Tsga10), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tsga10 (211484)
Length:
2051
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110976.1
NBCI Gene record:
Tsga10 (211484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102008 GCCCTCATTATGTGCGAACAA pLKO.1 1325 3UTR 100% 4.950 6.930 N Tsga10 n/a
2 TRCN0000102009 CAAACTGTGATGTAGAGCTTT pLKO.1 584 3UTR 100% 4.950 3.465 N Tsga10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14285 pDONR223 100% 50.3% None (many diffs) n/a
2 ccsbBroad304_14285 pLX_304 0% 50.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473689 CCATCAGATCATGACCTAGCGTTC pLX_317 19.9% 50.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV