Transcript: Human NR_111944.3

Homo sapiens ribosomal protein S17 (RPS17), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RPS17 (6218)
Length:
609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111944.3
NBCI Gene record:
RPS17 (6218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074884 GCCTTGGATCAGGAGATTATT pLKO.1 297 3UTR 100% 15.000 10.500 N RPS17 n/a
2 TRCN0000290976 GCCTTGGATCAGGAGATTATT pLKO_005 297 3UTR 100% 15.000 10.500 N RPS17 n/a
3 TRCN0000074885 CCCAGTAAGAGGTATCTCCAT pLKO.1 221 3UTR 100% 2.640 1.848 N RPS17 n/a
4 TRCN0000291043 CCCAGTAAGAGGTATCTCCAT pLKO_005 221 3UTR 100% 2.640 1.848 N RPS17 n/a
5 TRCN0000074883 CGCAACAAGATAGCAGGTTAT pLKO.1 168 3UTR 100% 10.800 6.480 N RPS17 n/a
6 TRCN0000290975 CGCAACAAGATAGCAGGTTAT pLKO_005 168 3UTR 100% 10.800 6.480 N RPS17 n/a
7 TRCN0000255643 CAACGACTTCCACACGAACAA pLKO_005 104 3UTR 100% 4.950 2.970 N RPS17P16 n/a
8 TRCN0000074887 CAGGAGATTATTGAAGTAGAT pLKO.1 306 3UTR 100% 4.950 2.970 N RPS17 n/a
9 TRCN0000265672 AGAGAAAGGAGAGACAATTAT pLKO_005 261 3UTR 100% 15.000 7.500 Y RPS17P16 n/a
10 TRCN0000074886 AGAGAGAAAGGAGAGACAATT pLKO.1 259 3UTR 100% 13.200 6.600 Y RPS17 n/a
11 TRCN0000291044 AGAGAGAAAGGAGAGACAATT pLKO_005 259 3UTR 100% 13.200 6.600 Y RPS17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06900 pDONR223 100% 66.3% None (many diffs) n/a
2 ccsbBroad304_06900 pLX_304 0% 66.3% V5 (many diffs) n/a
3 TRCN0000469943 GTAAATTCATTACACTTATCCACG pLX_317 100% 66.3% V5 (many diffs) n/a
4 ccsbBroadEn_15582 pDONR223 0% 66.3% None (many diffs) n/a
5 ccsbBroad304_15582 pLX_304 0% 66.3% V5 (many diffs) n/a
6 TRCN0000471869 ACCTGATCCCCATTCCCTATATGT pLX_317 92.7% 66.3% V5 (many diffs) n/a
Download CSV