Transcript: Human NR_111974.1

Homo sapiens RAB guanine nucleotide exchange factor 1 pseudogene (GS1-124K5.11), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
GS1-124K5.11 (493754)
Length:
1687
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111974.1
NBCI Gene record:
GS1-124K5.11 (493754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364999 ATATGACATGGCTTATGTTAA pLKO_005 1634 3UTR 100% 13.200 6.600 Y TOMM20 n/a
2 TRCN0000369983 GTTACTAGCTCAAGGTGAATA pLKO_005 1153 3UTR 100% 13.200 6.600 Y TOMM20 n/a
3 TRCN0000147757 GAAGAAATACAGCTTGGTGAA pLKO.1 1130 3UTR 100% 4.050 2.025 Y TOMM20 n/a
4 TRCN0000149946 GCTGTTCAGAAGTTCTTCCTT pLKO.1 1109 3UTR 100% 3.000 1.500 Y TOMM20 n/a
5 TRCN0000102137 CCCAACTTCAAGAACAGGCTT pLKO.1 1010 3UTR 100% 2.640 1.320 Y Tomm20 n/a
6 TRCN0000288026 CCCAACTTCAAGAACAGGCTT pLKO_005 1010 3UTR 100% 2.640 1.320 Y Tomm20 n/a
7 TRCN0000369950 GGCGTAGACCATCTGACAAAT pLKO_005 1181 3UTR 100% 13.200 6.600 Y TOMM20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02247 pDONR223 100% 23.7% None (many diffs) n/a
2 ccsbBroad304_02247 pLX_304 0% 23.7% V5 (many diffs) n/a
3 TRCN0000470242 TTCATGAGAAGCGCGTGTGCCCGG pLX_317 98.6% 23.7% V5 (many diffs) n/a
Download CSV