Transcript: Human NR_119375.1

Homo sapiens long intergenic non-protein coding RNA 1725 (LINC01725), long non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LINC01725 (101927587)
Length:
3166
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_119375.1
NBCI Gene record:
LINC01725 (101927587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_119375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165230 GCAGTGGCTTACACCTGTAAT pLKO.1 1983 3UTR 100% 13.200 6.600 Y BAIAP2-DT n/a
2 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1994 3UTR 100% 4.950 2.475 Y CFLAR n/a
3 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1994 3UTR 100% 4.950 2.475 Y C19orf31 n/a
4 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2033 3UTR 100% 4.050 2.025 Y P3H4 n/a
5 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2033 3UTR 100% 4.050 2.025 Y ORAI2 n/a
6 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2033 3UTR 100% 4.050 2.025 Y P3H4 n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2160 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_119375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.