Transcript: Human NR_119385.1

Homo sapiens ZNF295 antisense RNA 1 (ZNF295-AS1), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF295-AS1 (150142)
Length:
823
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_119385.1
NBCI Gene record:
ZNF295-AS1 (150142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_119385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167565 GATACTGACTTGAGATCTTAT pLKO.1 556 3UTR 100% 13.200 10.560 N ZNF295-AS1 n/a
2 TRCN0000168385 GAGGTGATACTGACTTGAGAT pLKO.1 551 3UTR 100% 4.950 3.465 N ZNF295-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_119385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10560 pDONR223 100% 49.8% None 1_213del;307T>C;625_823del n/a
2 ccsbBroad304_10560 pLX_304 0% 49.8% V5 (not translated due to prior stop codon) 1_213del;307T>C;625_823del n/a
3 TRCN0000471904 CCCAGTGTTTGCAGAGGTTGTTTA pLX_317 100% 49.8% V5 (not translated due to prior stop codon) 1_213del;307T>C;625_823del n/a
Download CSV