Transcript: Human NR_120445.1

Homo sapiens ETS variant transcription factor 1 (ETV1), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-27
Taxon:
Homo sapiens (human)
Gene:
ETV1 (2115)
Length:
6583
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_120445.1
NBCI Gene record:
ETV1 (2115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_120445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430096 CAACGAAGGCTACGTGTATTA pLKO_005 1911 3UTR 100% 13.200 18.480 N ETV1 n/a
2 TRCN0000418451 TATCCACTTGGAGACTATTTG pLKO_005 2337 3UTR 100% 13.200 18.480 N ETV1 n/a
3 TRCN0000428550 AGCCGTTCACTCCGCTATTAC pLKO_005 1666 3UTR 100% 13.200 9.240 N ETV1 n/a
4 TRCN0000013924 CCACAGTCCATGTTCAGAAAT pLKO.1 710 3UTR 100% 13.200 9.240 N ETV1 n/a
5 TRCN0000013923 GTGGGAGTAATCTAAACATTT pLKO.1 2121 3UTR 100% 13.200 9.240 N ETV1 n/a
6 TRCN0000013927 GAGAGATATGTCTACAAGTTT pLKO.1 1720 3UTR 100% 5.625 3.938 N ETV1 n/a
7 TRCN0000013925 CGACCCAGTGTATGAACACAA pLKO.1 1130 3UTR 100% 4.950 3.465 N ETV1 n/a
8 TRCN0000013926 GCATCTCCAAACTCAACTCAT pLKO.1 885 3UTR 100% 4.950 3.465 N ETV1 n/a
9 TRCN0000075474 TCAGGCTGAAAGTTTGGCTTT pLKO.1 656 3UTR 100% 4.050 2.835 N Etv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_120445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00520 pDONR223 100% 21.7% None 1_434del;1374_1437del;1930_6583del n/a
2 ccsbBroad304_00520 pLX_304 27.6% 21.7% V5 1_434del;1374_1437del;1930_6583del n/a
3 TRCN0000469733 CACAGGTTACAGTGGTGTTCAGCC pLX_317 10.3% 21.7% V5 1_434del;1374_1437del;1930_6583del n/a
Download CSV