Transcript: Mouse NR_121616.1

Mus musculus N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 (Ndst3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-05-23
Taxon:
Mus musculus (mouse)
Gene:
Ndst3 (83398)
Length:
5550
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121616.1
NBCI Gene record:
Ndst3 (83398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097827 CGGTTCCATTATCACACTGAA pLKO.1 611 3UTR 100% 4.950 3.960 N Ndst3 n/a
2 TRCN0000097828 GCGCACACAAATCACAAATTT pLKO.1 1312 3UTR 100% 15.000 10.500 N Ndst3 n/a
3 TRCN0000097826 CCCTCCATTTCAGTTGCTAAT pLKO.1 2537 3UTR 100% 10.800 7.560 N Ndst3 n/a
4 TRCN0000097829 GCTCTGAAATTTAGCTTCTAT pLKO.1 2406 3UTR 100% 5.625 3.938 N Ndst3 n/a
5 TRCN0000097825 GCTGACATACATCTCCACATT pLKO.1 4937 3UTR 100% 4.950 3.465 N Ndst3 n/a
6 TRCN0000035993 CGTTTGATTCTCATAAAGGTT pLKO.1 2659 3UTR 100% 3.000 2.100 N NDST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07396 pDONR223 100% 41% None (many diffs) n/a
2 ccsbBroad304_07396 pLX_304 0% 41% V5 (many diffs) n/a
3 TRCN0000491282 ACGTAGTCCTAAACAGAATCCTGA pLX_317 10.9% 41% V5 (many diffs) n/a
Download CSV