Transcript: Mouse NR_121643.1

Mus musculus phospholipid phosphatase 5 (Plpp5), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2015-11-11
Taxon:
Mus musculus (mouse)
Gene:
Plpp5 (71910)
Length:
1404
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121643.1
NBCI Gene record:
Plpp5 (71910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080718 CCTCGCCAAGTTTCTAAGGAA pLKO.1 209 3UTR 100% 3.000 4.200 N Plpp5 n/a
2 TRCN0000080721 CACTGGCAAGATGTGCTAGTT pLKO.1 573 3UTR 100% 4.950 3.465 N Plpp5 n/a
3 TRCN0000080720 CCTAGCTCTGAATGGTGTCTT pLKO.1 278 3UTR 100% 4.950 3.465 N Plpp5 n/a
4 TRCN0000080722 TCTGTGCCTTTCTGTCACCTT pLKO.1 502 3UTR 100% 2.640 1.848 N Plpp5 n/a
5 TRCN0000040240 CCCAGTGGACATTCTTCCTTT pLKO.1 435 3UTR 100% 4.950 3.465 N PLPP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12825 pDONR223 100% 33.8% None (many diffs) n/a
2 ccsbBroad304_12825 pLX_304 0% 33.8% V5 (many diffs) n/a
3 TRCN0000467220 ATTTTGTGCCGACTTTTCAACGTC pLX_317 59.3% 33.8% V5 (many diffs) n/a
4 ccsbBroadEn_16036 pDONR223 0% 26.1% None (many diffs) n/a
5 ccsbBroad304_16036 pLX_304 0% 26.1% V5 (many diffs) n/a
Download CSV