Transcript: Mouse NR_122039.1

Mus musculus TSC22 domain family, member 3 (Tsc22d3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tsc22d3 (14605)
Length:
1790
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_122039.1
NBCI Gene record:
Tsc22d3 (14605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_122039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424941 CTGATGTACGCTGTGAGAGAG pLKO_005 229 3UTR 100% 4.050 5.670 N Tsc22d3 n/a
2 TRCN0000013793 CCTAGTTCTTTCCAGTTTGTT pLKO.1 493 3UTR 100% 5.625 4.500 N TSC22D3 n/a
3 TRCN0000422105 CATCTCATGTGGAGAACTTTA pLKO_005 531 3UTR 100% 13.200 9.240 N Tsc22d3 n/a
4 TRCN0000431139 AGGTCCTAAAGGAGCAGATTC pLKO_005 257 3UTR 100% 10.800 7.560 N Tsc22d3 n/a
5 TRCN0000085743 CCTGACAATGACTGTTCCTAT pLKO.1 840 3UTR 100% 4.950 3.465 N Tsc22d3 n/a
6 TRCN0000432157 GATTCGTGAGCTGCTTGAGAA pLKO_005 273 3UTR 100% 4.950 3.465 N Tsc22d3 n/a
7 TRCN0000085747 CCTAGACAACAAGATTGAGCA pLKO.1 183 3UTR 100% 2.640 1.848 N Tsc22d3 n/a
8 TRCN0000085746 CCCTGGTGGTTCTGCGGTGTA pLKO.1 429 3UTR 100% 0.000 0.000 N Tsc22d3 n/a
9 TRCN0000085745 GCGCGAGAACACCCTCCTGAA pLKO.1 309 3UTR 100% 0.000 0.000 N Tsc22d3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_122039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06126 pDONR223 100% 11.2% None (many diffs) n/a
2 ccsbBroad304_06126 pLX_304 0% 11.2% V5 (many diffs) n/a
3 TRCN0000470835 CGCGCGATGTAGTTTTCTGCACTA pLX_317 100% 11.2% V5 (many diffs) n/a
Download CSV