Transcript: Human NR_123717.2

Homo sapiens vesicle associated membrane protein 1 (VAMP1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
VAMP1 (6843)
Length:
965
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_123717.2
NBCI Gene record:
VAMP1 (6843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_123717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151479 CCAAGCTAAAGAGGAAGTATT pLKO.1 270 3UTR 100% 13.200 9.240 N VAMP1 n/a
2 TRCN0000219759 GCAGGCAGGAGCATCACAATT pLKO.1 235 3UTR 100% 13.200 9.240 N VAMP1 n/a
3 TRCN0000219760 TGCCATCATCGTGGTAGTTAT pLKO.1 334 3UTR 100% 13.200 9.240 N VAMP1 n/a
4 TRCN0000380882 GAGCAGTGCTGCCAAGCTAAA pLKO_005 259 3UTR 100% 10.800 7.560 N Vamp1 n/a
5 TRCN0000179134 GCCAAGCTAAAGAGGAAGTAT pLKO.1 269 3UTR 100% 5.625 3.938 N VAMP1 n/a
6 TRCN0000155272 GCTGGAAGAAAGCAGTCAGTA pLKO.1 374 3UTR 100% 4.950 3.465 N VAMP1 n/a
7 TRCN0000240460 GGTGGACATCATACGTGTGAA pLKO_005 151 3UTR 100% 4.950 3.465 N VAMP1 n/a
8 TRCN0000240459 ACTGCAAGATGATGATCATGC pLKO_005 300 3UTR 100% 4.050 2.835 N VAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_123717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07022 pDONR223 100% 28.6% None (many diffs) n/a
2 ccsbBroad304_07022 pLX_304 0% 28.6% V5 (many diffs) n/a
3 TRCN0000475028 GTTAGAAAACAATAGATGGTGTGA pLX_317 93.8% 28.6% V5 (many diffs) n/a
Download CSV