Transcript: Human NR_126399.1

Homo sapiens chromosome 8 open reading frame 31 (C8orf31), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2019-03-04
Taxon:
Homo sapiens (human)
Gene:
C8orf31 (286122)
Length:
1919
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126399.1
NBCI Gene record:
C8orf31 (286122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162781 CCTCTTAACGATCAACGGTAA pLKO.1 1238 3UTR 100% 4.050 5.670 N C8orf31 n/a
2 TRCN0000162500 CCTTTAATCACTCTAGCTCAA pLKO.1 1571 3UTR 100% 4.050 5.670 N C8orf31 n/a
3 TRCN0000164672 CCCTCTTAACGATCAACGGTA pLKO.1 1237 3UTR 100% 2.640 3.696 N C8orf31 n/a
4 TRCN0000163769 GCTGATCTGGAAGACAAGTAA pLKO.1 923 3UTR 100% 5.625 3.938 N C8orf31 n/a
5 TRCN0000163615 CAACCGTCAATACAAAGGGAT pLKO.1 1182 3UTR 100% 2.640 1.848 N C8orf31 n/a
6 TRCN0000162868 GCCTTTAATCACTCTAGCTCA pLKO.1 1570 3UTR 100% 2.640 1.848 N C8orf31 n/a
7 TRCN0000161297 GATCTGGAAGACAAGTAACAT pLKO.1 926 3UTR 100% 5.625 3.375 N C8orf31 n/a
8 TRCN0000162957 GAAGCGATGAACCATACTGTT pLKO.1 1014 3UTR 100% 4.950 2.970 N C8orf31 n/a
9 TRCN0000159655 GAGAAATGCTTTCTTAGCATA pLKO.1 1276 3UTR 100% 0.495 0.297 N C8orf31 n/a
10 TRCN0000139012 CGCCTGTAATCCCAGAACTTT pLKO.1 1660 3UTR 100% 5.625 2.813 Y CCDC57 n/a
11 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 1715 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13562 pDONR223 100% 7.3% None (many diffs) n/a
2 ccsbBroad304_13562 pLX_304 0% 7.3% V5 (many diffs) n/a
3 TRCN0000466147 AATTGTTGAGCTTCTATCTGGTTC pLX_317 100% 7.3% V5 (many diffs) n/a
Download CSV