Transcript: Human NR_130317.2

Homo sapiens transmembrane protein 143 (TMEM143), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TMEM143 (55260)
Length:
1917
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130317.2
NBCI Gene record:
TMEM143 (55260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233173 TGGCGCACATGCTGTACTATC pLKO_005 687 3UTR 100% 10.800 15.120 N TMEM143 n/a
2 TRCN0000163064 CCTGGTACTGAAGAGTTTCAA pLKO.1 418 3UTR 100% 5.625 7.875 N TMEM143 n/a
3 TRCN0000166539 CTATCGCAGTACGTCCAACAA pLKO.1 703 3UTR 100% 4.950 6.930 N TMEM143 n/a
4 TRCN0000165629 GCTAGGTAGGTGAACCAGAAA pLKO.1 1698 3UTR 100% 4.950 6.930 N TMEM143 n/a
5 TRCN0000166092 GAGGAGATACTTTAAGCGGGT pLKO.1 367 3UTR 100% 0.540 0.756 N TMEM143 n/a
6 TRCN0000166540 CCGCCAGGTAGAAGAGTTAAA pLKO.1 1395 3UTR 100% 13.200 9.240 N TMEM143 n/a
7 TRCN0000233172 CTGCGGAGAGGAGATACTTTA pLKO_005 360 3UTR 100% 13.200 9.240 N TMEM143 n/a
8 TRCN0000166091 GAGGTCCAGGTGACAGTAAAT pLKO.1 230 3UTR 100% 13.200 9.240 N TMEM143 n/a
9 TRCN0000233171 CAGTAAATTTGGATCAGTATG pLKO_005 243 3UTR 100% 10.800 7.560 N TMEM143 n/a
10 TRCN0000233170 CCTCGATCAGCCATCACTAAC pLKO_005 79 3UTR 100% 10.800 7.560 N TMEM143 n/a
11 TRCN0000163844 CTGGTACTGAAGAGTTTCAAG pLKO.1 419 3UTR 100% 4.950 3.465 N TMEM143 n/a
12 TRCN0000165088 GACACCTGGTACTGAAGAGTT pLKO.1 414 3UTR 100% 4.950 3.465 N TMEM143 n/a
13 TRCN0000233174 AGTCCCACCCTCACCATAAAT pLKO_005 1302 3UTR 100% 15.000 10.500 N TMEM143 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03568 pDONR223 100% 46.6% None (many diffs) n/a
2 ccsbBroad304_03568 pLX_304 0% 46.6% V5 (many diffs) n/a
3 TRCN0000473001 AGCTACAACACGCCTGGGAGTTGC pLX_317 29.8% 46.6% V5 (many diffs) n/a
Download CSV