Transcript: Human NR_130761.2

Homo sapiens coiled-coil domain containing 25 (CCDC25), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CCDC25 (55246)
Length:
3477
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130761.2
NBCI Gene record:
CCDC25 (55246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122416 GAGATCCTGAACCGATTAGAA pLKO.1 378 3UTR 100% 5.625 4.500 N CCDC25 n/a
2 TRCN0000415953 GTTGAACTTGACAGCATATAA pLKO_005 775 3UTR 100% 15.000 10.500 N CCDC25 n/a
3 TRCN0000415274 CTGTCCCTGATTTCTCGATTA pLKO_005 1019 3UTR 100% 10.800 7.560 N CCDC25 n/a
4 TRCN0000144631 GATGGCAATGATTCAGATGAA pLKO.1 548 3UTR 100% 4.950 3.465 N CCDC25 n/a
5 TRCN0000143604 GCAGAGAAAGAATGCAGAGAT pLKO.1 432 3UTR 100% 4.950 2.970 N CCDC25 n/a
6 TRCN0000144883 GAAATGAAGAAGAAGAGGGAA pLKO.1 513 3UTR 100% 2.640 1.584 N CCDC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08496 pDONR223 100% 13% None (many diffs) n/a
2 ccsbBroad304_08496 pLX_304 0% 13% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000480827 CGCTCATGACCGGATGACATGGGC pLX_317 63.1% 13% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV