Transcript: Human NR_130910.2

Homo sapiens yippee like 1 (YPEL1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
YPEL1 (29799)
Length:
4681
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130910.2
NBCI Gene record:
YPEL1 (29799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157987 CCAATCATGACGAGCTCATCT pLKO.1 436 3UTR 100% 4.950 6.930 N YPEL1 n/a
2 TRCN0000157604 GTGGAAATACGAGCATGCCTT pLKO.1 989 3UTR 100% 2.640 3.696 N YPEL1 n/a
3 TRCN0000436899 CACCGAACGTACAGCTGTATC pLKO_005 396 3UTR 100% 10.800 7.560 N YPEL1 n/a
4 TRCN0000418131 GGGAGTAATGTGCGAACTTTC pLKO_005 1081 3UTR 100% 10.800 7.560 N YPEL1 n/a
5 TRCN0000154345 CCCTGGATGTACTTGAAGAAA pLKO.1 2455 3UTR 100% 5.625 3.938 N YPEL1 n/a
6 TRCN0000156614 GCCTTTGAGAGCAGTCAGAAA pLKO.1 1005 3UTR 100% 4.950 2.970 N YPEL1 n/a
7 TRCN0000157911 CAAAGACAATGGCTGGGAGTA pLKO.1 1067 3UTR 100% 4.050 2.430 N YPEL1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1462 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1463 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08123 pDONR223 100% 7.6% None (many diffs) n/a
2 ccsbBroad304_08123 pLX_304 0% 7.6% V5 (many diffs) n/a
3 TRCN0000472132 TTCAACAATTGAGCCTCATAACTA pLX_317 100% 7.6% V5 (many diffs) n/a
Download CSV