Transcript: Human NR_131773.2

Homo sapiens zinc finger protein 346 (ZNF346), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF346 (23567)
Length:
4169
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131773.2
NBCI Gene record:
ZNF346 (23567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_131773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219819 CCATGGAATGGAGACATTAAA pLKO.1 364 3UTR 100% 15.000 21.000 N ZNF346 n/a
2 TRCN0000240712 TTTGCTGCGCCTTGCTTATTT pLKO_005 273 3UTR 100% 15.000 21.000 N ZNF346 n/a
3 TRCN0000240714 ATGGGAGCTTGGAGCTAATAC pLKO_005 1244 3UTR 100% 13.200 18.480 N ZNF346 n/a
4 TRCN0000219820 CTCATTGGTCCGGGCTAATTC pLKO.1 924 3UTR 100% 13.200 18.480 N ZNF346 n/a
5 TRCN0000180587 GCTCAAACTAATGGCACGCTA pLKO.1 543 3UTR 100% 2.640 3.696 N ZNF346 n/a
6 TRCN0000099259 AGTGAAGAGATACCTAGCAAT pLKO.1 343 3UTR 100% 4.950 3.960 N Zfp346 n/a
7 TRCN0000316265 AGTGAAGAGATACCTAGCAAT pLKO_005 343 3UTR 100% 4.950 3.960 N Zfp346 n/a
8 TRCN0000240713 AGCCTCTGCCATGCAACTTTC pLKO_005 460 3UTR 100% 10.800 7.560 N ZNF346 n/a
9 TRCN0000240715 TCCCAGAAGCTGGCACATTAC pLKO_005 299 3UTR 100% 10.800 7.560 N ZNF346 n/a
10 TRCN0000147001 CACCAGAATAGAGAGATGATA pLKO.1 421 3UTR 100% 5.625 3.938 N ZNF346 n/a
11 TRCN0000179045 CCAGAAGAACCAATGTCTCTT pLKO.1 232 3UTR 100% 4.950 3.465 N ZNF346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02797 pDONR223 100% 17% None 1_43del;413_414ins145;781_4169del n/a
2 ccsbBroad304_02797 pLX_304 0% 17% V5 1_43del;413_414ins145;781_4169del n/a
3 TRCN0000468508 CTTGTGGTGCACCTCTCTAACCGC pLX_317 31.8% 17% V5 1_43del;413_414ins145;781_4169del n/a
Download CSV