Transcript: Mouse NR_131940.1

Mus musculus pumilio RNA-binding family member 3 (Pum3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-05-24
Taxon:
Mus musculus (mouse)
Gene:
Pum3 (52874)
Length:
3588
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131940.1
NBCI Gene record:
Pum3 (52874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173994 GCGGACCTAAAGTCACATCTA pLKO.1 255 3UTR 100% 4.950 6.930 N Pum3 n/a
2 TRCN0000194175 GCGTTTGACTGTATTGATGAT pLKO.1 1339 3UTR 100% 4.950 6.930 N Pum3 n/a
3 TRCN0000175742 GCGACTTGGTTGAATTAAGTA pLKO.1 735 3UTR 100% 5.625 4.500 N Pum3 n/a
4 TRCN0000217255 CAGGACATCTGGTTCTCAAAT pLKO.1 1774 3UTR 100% 13.200 9.240 N Pum3 n/a
5 TRCN0000174903 GCATTTGTTAAAGGACCTATT pLKO.1 2146 3UTR 100% 10.800 7.560 N Pum3 n/a
6 TRCN0000174938 GTTTAATGTCAACTGTCTGAT pLKO.1 2198 3UTR 100% 4.950 3.465 N Pum3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07512 pDONR223 100% 46.3% None (many diffs) n/a
2 ccsbBroad304_07512 pLX_304 0% 46.3% V5 (many diffs) n/a
3 TRCN0000476623 ACACAACCGCCAGCAGCAAGTTGA pLX_317 20.2% 46.3% V5 (many diffs) n/a
Download CSV