Transcript: Human NR_132323.1

Homo sapiens major histocompatibility complex, class I, V (pseudogene) (HLA-V), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
HLA-V (352962)
Length:
1295
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132323.1
NBCI Gene record:
HLA-V (352962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13714 pDONR223 100% 43.7% None 1_102del;670_1295del n/a
2 ccsbBroad304_13714 pLX_304 0% 43.7% V5 1_102del;670_1295del n/a
3 TRCN0000468125 TCGTCTTGCTGTGCCGCTCTGCCA pLX_317 71.7% 43.7% V5 1_102del;670_1295del n/a
4 ccsbBroadEn_13715 pDONR223 100% 24.5% None (many diffs) n/a
5 ccsbBroad304_13715 pLX_304 0% 24.5% V5 (many diffs) n/a
6 TRCN0000473122 GGGTCAGTAGTGGATGTACCAGTA pLX_317 100% 24.5% V5 (many diffs) n/a
Download CSV