Transcript: Mouse NR_132325.1

Mus musculus RAB28, member RAS oncogene family (Rab28), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rab28 (100972)
Length:
1572
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132325.1
NBCI Gene record:
Rab28 (100972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_132325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100697 GCAGACGATAGGACTGGATTT pLKO.1 326 3UTR 100% 10.800 8.640 N Rab28 n/a
2 TRCN0000353972 GCAGACGATAGGACTGGATTT pLKO_005 326 3UTR 100% 10.800 8.640 N Rab28 n/a
3 TRCN0000100695 GCTTCAAATGAGGCTGTAATA pLKO.1 1242 3UTR 100% 13.200 9.240 N Rab28 n/a
4 TRCN0000325395 GCTTCAAATGAGGCTGTAATA pLKO_005 1242 3UTR 100% 13.200 9.240 N Rab28 n/a
5 TRCN0000100699 GCTGATAAGCACTTACGATTT pLKO.1 532 3UTR 100% 10.800 7.560 N Rab28 n/a
6 TRCN0000325394 GCTGATAAGCACTTACGATTT pLKO_005 532 3UTR 100% 10.800 7.560 N Rab28 n/a
7 TRCN0000100696 CCTGGGAATCAAATTAAACAA pLKO.1 642 3UTR 100% 5.625 3.938 N Rab28 n/a
8 TRCN0000325393 CCTGGGAATCAAATTAAACAA pLKO_005 642 3UTR 100% 5.625 3.938 N Rab28 n/a
9 TRCN0000100698 GCACACACTGTATTGATAGTT pLKO.1 776 3UTR 100% 5.625 3.938 N Rab28 n/a
10 TRCN0000325396 GCACACACTGTATTGATAGTT pLKO_005 776 3UTR 100% 5.625 3.938 N Rab28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07402 pDONR223 100% 31.5% None (many diffs) n/a
2 ccsbBroad304_07402 pLX_304 0% 31.5% V5 (many diffs) n/a
3 TRCN0000473153 TGGCCGTGCGGCGTCAATTGTCCA pLX_317 86% 31.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV