Transcript: Human NR_132407.1

Homo sapiens tRNA isopentenyltransferase 1 (TRIT1), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
TRIT1 (54802)
Length:
1773
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132407.1
NBCI Gene record:
TRIT1 (54802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434687 AGGATTGACTGCATCCCTTTA pLKO_005 1371 3UTR 100% 10.800 15.120 N TRIT1 n/a
2 TRCN0000111292 CCAGCTTCTAAAGAAAGGTAT pLKO.1 546 3UTR 100% 4.950 6.930 N Trit1 n/a
3 TRCN0000423605 AGTCTCACGTTCTCTATAATA pLKO_005 1189 3UTR 100% 15.000 10.500 N TRIT1 n/a
4 TRCN0000111294 CAGCTTCTAAAGAAAGGTATT pLKO.1 547 3UTR 100% 10.800 7.560 N Trit1 n/a
5 TRCN0000034597 CCAGGACTATCAACATGGTAT pLKO.1 450 3UTR 100% 4.950 3.465 N TRIT1 n/a
6 TRCN0000034595 CCATAGAAAGTCAGAGTGTTT pLKO.1 941 3UTR 100% 4.950 3.465 N TRIT1 n/a
7 TRCN0000433271 TCAATTGGCTTCAAGGAATTT pLKO_005 478 3UTR 100% 13.200 7.920 N TRIT1 n/a
8 TRCN0000375362 CTAGATGAGCGCTTGGATAAA pLKO_005 340 3UTR 100% 13.200 18.480 N Trit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12085 pDONR223 100% 51.2% None (many diffs) n/a
2 ccsbBroad304_12085 pLX_304 0% 51.2% V5 (many diffs) n/a
3 TRCN0000465214 TTTTAGCCTGGCGAAAACTGCTGC pLX_317 2.2% 51.2% V5 (many diffs) n/a
Download CSV