Transcript: Human NR_132660.2

Homo sapiens CD38 molecule (CD38), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CD38 (952)
Length:
5484
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132660.2
NBCI Gene record:
CD38 (952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050868 GCATACCTTTATTGTGATCTA pLKO.1 1028 3UTR 100% 4.950 3.960 N CD38 n/a
2 TRCN0000050870 CCAAAGTGTATGGGATGCTTT pLKO.1 333 3UTR 100% 4.950 3.465 N CD38 n/a
3 TRCN0000050869 CCAGAGAAGGTTCAGACACTA pLKO.1 645 3UTR 100% 4.950 3.465 N CD38 n/a
4 TRCN0000050871 CTGAGGATTCATCTTGCACAT pLKO.1 823 3UTR 100% 4.050 2.835 N CD38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00258 pDONR223 100% 13.5% None 1_87del;450_451ins136;852_5484del n/a
2 ccsbBroad304_00258 pLX_304 0% 13.5% V5 1_87del;450_451ins136;852_5484del n/a
3 TRCN0000479471 CCCGACCGCCGTAAACGATGTCAC pLX_317 41.8% 13.5% V5 1_87del;450_451ins136;852_5484del n/a
Download CSV