Transcript: Human NR_133927.1

Homo sapiens V-set and transmembrane domain containing 2A (VSTM2A), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
VSTM2A (222008)
Length:
2401
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_133927.1
NBCI Gene record:
VSTM2A (222008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_133927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129166 GAAAGTCCAAGGCAATGACAT pLKO.1 110 3UTR 100% 4.950 6.930 N VSTM2A n/a
2 TRCN0000128947 CCACAAGCTTCAGATTTCCAA pLKO.1 134 3UTR 100% 3.000 4.200 N VSTM2A n/a
3 TRCN0000373860 AGGCCTATCTGAAAGTCAATG pLKO_005 235 3UTR 100% 10.800 7.560 N VSTM2A n/a
4 TRCN0000435368 AGGCCTATCTGAAAGTCAATG pLKO_005 235 3UTR 100% 10.800 7.560 N Vstm2a n/a
5 TRCN0000128755 CCCAAACAAAGTCCACAATCA pLKO.1 420 3UTR 100% 4.950 3.465 N VSTM2A n/a
6 TRCN0000127586 CACAGTGAAAGTCCAAGGCAA pLKO.1 104 3UTR 100% 2.640 1.848 N VSTM2A n/a
7 TRCN0000129730 CAGATTTCCAAAGTGAGGAAA pLKO.1 144 3UTR 100% 0.495 0.347 N VSTM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_133927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13431 pDONR223 100% 19.2% None (many diffs) n/a
2 ccsbBroad304_13431 pLX_304 0% 19.2% V5 (many diffs) n/a
3 TRCN0000473383 AAGTCGTGTGCAGTGTTGCCGGTC pLX_317 64.3% 19.2% V5 (many diffs) n/a
Download CSV