Transcript: Human NR_134606.1

Homo sapiens inversin (INVS), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-03-19
Taxon:
Homo sapiens (human)
Gene:
INVS (27130)
Length:
4931
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134606.1
NBCI Gene record:
INVS (27130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113793 CCGAGGACTTTCAGGTATCTA pLKO.1 2810 3UTR 100% 5.625 7.875 N INVS n/a
2 TRCN0000113792 CCGTGAAGTTATTACTGGAAA pLKO.1 1371 3UTR 100% 4.950 6.930 N INVS n/a
3 TRCN0000429944 GAGCTCCGACTGCAGATAATT pLKO_005 2896 3UTR 100% 15.000 12.000 N INVS n/a
4 TRCN0000431394 ACTGGGCAGCCAACCATAAAG pLKO_005 816 3UTR 100% 13.200 10.560 N INVS n/a
5 TRCN0000434008 AGCTGCAATATAACGTCTTAT pLKO_005 989 3UTR 100% 13.200 10.560 N INVS n/a
6 TRCN0000113794 GCAGTGATGATGTCCTTAGAA pLKO.1 1254 3UTR 100% 5.625 4.500 N INVS n/a
7 TRCN0000427386 GGATACCTTGATGCCATTAAA pLKO_005 1754 3UTR 100% 15.000 10.500 N INVS n/a
8 TRCN0000113795 CTTAGAACTATGCTGAGCTTA pLKO.1 1268 3UTR 100% 4.950 3.465 N INVS n/a
9 TRCN0000113791 GCATAGACTATGTCTGTGCAA pLKO.1 3628 3UTR 100% 2.640 1.848 N INVS n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3871 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14119 pDONR223 100% 6% None (many diffs) n/a
2 ccsbBroad304_14119 pLX_304 0% 6% V5 (many diffs) n/a
3 TRCN0000465713 TATAGTTTGTCCTTGCTAAACACC pLX_317 100% 6% V5 (many diffs) n/a
Download CSV