Transcript: Human NR_134677.2

Homo sapiens WD repeat domain 31 (WDR31), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
WDR31 (114987)
Length:
4839
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134677.2
NBCI Gene record:
WDR31 (114987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243984 AGACAGTTGTGGCCTATAATT pLKO_005 417 3UTR 100% 15.000 21.000 N WDR31 n/a
2 TRCN0000243983 ATCACCAAGGTAGCCTGTATT pLKO_005 485 3UTR 100% 13.200 9.240 N WDR31 n/a
3 TRCN0000243985 TCAGTGTTGTAAGTCCAATAA pLKO_005 1446 3UTR 100% 13.200 9.240 N WDR31 n/a
4 TRCN0000150029 CATGATTGCAAGGTGAAGATT pLKO.1 1112 3UTR 100% 5.625 3.938 N WDR31 n/a
5 TRCN0000179567 GAACATGAGATCACCAAGGTA pLKO.1 476 3UTR 100% 3.000 2.100 N WDR31 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3569 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04673 pDONR223 100% 20.9% None (many diffs) n/a
2 ccsbBroad304_04673 pLX_304 0% 20.9% V5 (many diffs) n/a
3 TRCN0000470624 GCAATCACTTGGACAAACTCACCC pLX_317 41.8% 20.9% V5 (many diffs) n/a
Download CSV