Transcript: Human NR_134905.2

Homo sapiens trans-golgi network vesicle protein 23 homolog A (TVP23A), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TVP23A (780776)
Length:
1661
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134905.2
NBCI Gene record:
TVP23A (780776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268245 TTCGATGGTGGAACCAGATAG pLKO_005 419 3UTR 100% 10.800 15.120 N Tvp23a n/a
2 TRCN0000269932 TTCGATGGTGGAACCAGATAG pLKO_005 419 3UTR 100% 10.800 15.120 N TVP23A n/a
3 TRCN0000284094 CTTCTGGCTGGGCCTCATAAT pLKO_005 525 3UTR 100% 13.200 9.240 N TVP23A n/a
4 TRCN0000269854 CAGGAAGGTCTCTCCGAATAG pLKO_005 474 3UTR 100% 10.800 7.560 N TVP23A n/a
5 TRCN0000269877 GGAAGAGCCACTGGATCTTTG pLKO_005 449 3UTR 100% 10.800 7.560 N TVP23A n/a
6 TRCN0000047584 CGATGGTGGAACCAGATAGAT pLKO.1 421 3UTR 100% 5.625 3.938 N LOC283816 n/a
7 TRCN0000047583 CCCATGATATGGATTGTGTTT pLKO.1 550 3UTR 100% 4.950 3.465 N LOC283816 n/a
8 TRCN0000047587 GCTGGCCTTTAGGAAAGCCAA pLKO.1 364 3UTR 100% 2.640 1.848 N LOC283816 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05741 pDONR223 100% 27.3% None 1_301del;388_389ins145;796_1661del n/a
2 ccsbBroad304_05741 pLX_304 0% 27.3% V5 1_301del;388_389ins145;796_1661del n/a
3 TRCN0000480830 TATACTAGCCTCATTATCCTGTAT pLX_317 58.6% 27.3% V5 1_301del;388_389ins145;796_1661del n/a
Download CSV