Transcript: Human NR_135140.1

Homo sapiens YY1 associated factor 2 (YAF2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
YAF2 (10138)
Length:
4490
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135140.1
NBCI Gene record:
YAF2 (10138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095208 CAAGTGCATGATGTGCGATGT pLKO.1 299 3UTR 100% 4.050 3.240 N Yaf2 n/a
2 TRCN0000332306 CAAGTGCATGATGTGCGATGT pLKO_005 299 3UTR 100% 4.050 3.240 N Yaf2 n/a
3 TRCN0000244840 GAGATCTGACAGTCATTATTA pLKO_005 824 3UTR 100% 15.000 10.500 N YAF2 n/a
4 TRCN0000244842 TATTGGCATGTAACGAATTTA pLKO_005 1325 3UTR 100% 15.000 10.500 N YAF2 n/a
5 TRCN0000108025 CCATGCAAATACACAGATTAT pLKO.1 1044 3UTR 100% 13.200 9.240 N YAF2 n/a
6 TRCN0000257298 AGCAGGTTACTCAGCAGTTTG pLKO_005 647 3UTR 100% 10.800 7.560 N YAF2 n/a
7 TRCN0000244839 CGGAGTAGTGCTCAGCATTTG pLKO_005 790 3UTR 100% 10.800 7.560 N YAF2 n/a
8 TRCN0000108026 CCTCCTACACAGTCAAAGAAA pLKO.1 670 3UTR 100% 5.625 3.938 N YAF2 n/a
9 TRCN0000108028 CGAGGCCTTCAAGTGCATGAT pLKO.1 290 3UTR 100% 4.950 3.465 N YAF2 n/a
10 TRCN0000108027 GACAGTCATTATTACAGACTT pLKO.1 831 3UTR 100% 4.950 3.465 N YAF2 n/a
11 TRCN0000244841 TGAATGGAGAATCTCATTAAA pLKO_005 986 3UTR 100% 15.000 9.000 N YAF2 n/a
12 TRCN0000108029 GCCTCATCATTGAATGGAGAA pLKO.1 976 3UTR 100% 4.050 2.430 N YAF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07561 pDONR223 100% 13.6% None (many diffs) n/a
2 ccsbBroad304_07561 pLX_304 0% 13.6% V5 (many diffs) n/a
3 TRCN0000470372 CGGTATTACTATGAGTGCGCAACC pLX_317 77.3% 13.6% V5 (many diffs) n/a
Download CSV