Transcript: Human NR_135226.1

Homo sapiens PEST proteolytic signal containing nuclear protein (PCNP), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2018-12-23
Taxon:
Homo sapiens (human)
Gene:
PCNP (57092)
Length:
2204
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135226.1
NBCI Gene record:
PCNP (57092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330556 TAACTCCCTTATTACCTAAAC pLKO_005 842 3UTR 100% 10.800 15.120 N PCNP n/a
2 TRCN0000141408 CCATAGGTAGTCAGACGACAA pLKO.1 291 3UTR 100% 4.050 5.670 N PCNP n/a
3 TRCN0000330610 CCATAGGTAGTCAGACGACAA pLKO_005 291 3UTR 100% 4.050 5.670 N PCNP n/a
4 TRCN0000241465 GAAGCTGTGGGAGCGAAATAT pLKO_005 416 3UTR 100% 15.000 10.500 N Pcnp n/a
5 TRCN0000330557 TCCATGACCAAGACAATTAAA pLKO_005 457 3UTR 100% 15.000 10.500 N PCNP n/a
6 TRCN0000330613 AGAAGCTGTGGGAGCGAAATA pLKO_005 415 3UTR 100% 13.200 9.240 N PCNP n/a
7 TRCN0000141699 CCACCAGAACTTGAGGCAAAT pLKO.1 1228 3UTR 100% 10.800 7.560 N PCNP n/a
8 TRCN0000143782 GCAGCCTGTGTATATTCCTAA pLKO.1 1848 3UTR 100% 4.950 3.465 N PCNP n/a
9 TRCN0000143376 GAAATGTCCATGACCAAGACA pLKO.1 451 3UTR 100% 3.000 2.100 N PCNP n/a
10 TRCN0000122205 GACAAAGAAAGCATCAGCCAT pLKO.1 307 3UTR 100% 2.640 1.848 N PCNP n/a
11 TRCN0000144364 CCCAAGTAAGACAATGGAAAT pLKO.1 1903 3UTR 100% 10.800 6.480 N PCNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15117 pDONR223 75% 14.7% None (many diffs) n/a
2 ccsbBroadEn_12327 pDONR223 100% 11.2% None (many diffs) n/a
3 ccsbBroad304_12327 pLX_304 0% 11.2% V5 (many diffs) n/a
4 TRCN0000472449 TTCAGGAAAATAACCCAACGTCCT pLX_317 100% 11.2% V5 (many diffs) n/a
Download CSV