Transcript: Human NR_135565.2

Homo sapiens WD repeat domain 88 (WDR88), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
WDR88 (126248)
Length:
1817
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135565.2
NBCI Gene record:
WDR88 (126248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426613 CCATGAGACTGTGGAATATTG pLKO_005 1213 3UTR 100% 13.200 10.560 N WDR88 n/a
2 TRCN0000064522 CATTGCCGCATCCTATGATAA pLKO.1 536 3UTR 100% 13.200 9.240 N WDR88 n/a
3 TRCN0000064518 CTCTCTTTGAAGGGCCATAAT pLKO.1 1125 3UTR 100% 13.200 9.240 N WDR88 n/a
4 TRCN0000433631 GGATCATGGAATCTGCATAAT pLKO_005 677 3UTR 100% 13.200 9.240 N WDR88 n/a
5 TRCN0000425164 TGATAGGACTGTGGCTATTTG pLKO_005 1079 3UTR 100% 13.200 9.240 N WDR88 n/a
6 TRCN0000064519 CCTTTGGTAATCAAGTACAAA pLKO.1 1251 3UTR 100% 5.625 3.938 N WDR88 n/a
7 TRCN0000064521 GCCATGAAGGTTCTGTCAGTT pLKO.1 1012 3UTR 100% 4.950 3.465 N WDR88 n/a
8 TRCN0000064520 GCCGAGAACATCACCACCGTT pLKO.1 702 3UTR 100% 0.880 0.616 N WDR88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13115 pDONR223 100% 70.3% None 1_56del;1335_1817del n/a
2 ccsbBroad304_13115 pLX_304 0% 70.3% V5 1_56del;1335_1817del n/a
3 TRCN0000491268 CATCATTTTCAGCACATTGTGTAG pLX_317 26.4% 70.3% V5 1_56del;1335_1817del n/a
Download CSV