Transcript: Human NR_135918.2

Homo sapiens mitochondrial ribosomal protein S11 (MRPS11), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MRPS11 (64963)
Length:
3330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135918.2
NBCI Gene record:
MRPS11 (64963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152979 GAAATTTGAGGAGATCCCAAT pLKO.1 244 3UTR 100% 4.050 5.670 N MRPS11 n/a
2 TRCN0000275561 CGTGATCCACATCCGAGTTGT pLKO_005 377 3UTR 100% 4.950 3.960 N MRPS11 n/a
3 TRCN0000156564 GTTCAGCATTTACCCTCCCAT pLKO.1 187 3UTR 100% 2.640 2.112 N MRPS11 n/a
4 TRCN0000275499 GCTCCAGTGGGACCTTGTAAA pLKO_005 574 3UTR 100% 13.200 9.240 N MRPS11 n/a
5 TRCN0000155206 GAGATCCCAATTGCACACATT pLKO.1 254 3UTR 100% 4.950 3.465 N MRPS11 n/a
6 TRCN0000275498 GAGATCCCAATTGCACACATT pLKO_005 254 3UTR 100% 4.950 3.465 N MRPS11 n/a
7 TRCN0000156937 GCCTGGAAGTGATCTCAATCA pLKO.1 454 3UTR 100% 4.950 3.465 N MRPS11 n/a
8 TRCN0000275497 GCCTGGAAGTGATCTCAATCA pLKO_005 454 3UTR 100% 4.950 3.465 N MRPS11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03990 pDONR223 100% 15.3% None 1_10delAATTCAAGTC;291_292ins62;531_3330del n/a
2 ccsbBroad304_03990 pLX_304 0% 15.3% V5 1_10delAATTCAAGTC;291_292ins62;531_3330del n/a
3 TRCN0000471484 ATCCAAATGCGCGCCAGTTGCCTA pLX_317 78.5% 15.3% V5 1_10delAATTCAAGTC;291_292ins62;531_3330del n/a
4 ccsbBroadEn_12505 pDONR223 100% 15.2% None (many diffs) n/a
5 ccsbBroad304_12505 pLX_304 0% 15.2% V5 (many diffs) n/a
6 TRCN0000471848 TTTCGGCTTCCCCGAACACATCAT pLX_317 87.3% 15.2% V5 (many diffs) n/a
Download CSV