Transcript: Human NR_135922.1

Homo sapiens Putative uncharacterized protein DKFZp434K191 (LOC102725072), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LOC102725072 (102725072)
Length:
5935
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135922.1
NBCI Gene record:
LOC102725072 (102725072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204665 GCAAGTCGTCTCAGGAAACTT pLKO.1 1787 3UTR 100% 5.625 2.813 Y POM121L8P n/a
2 TRCN0000203630 CGCTGATCATGAAGTCAACAT pLKO.1 1762 3UTR 100% 4.950 2.475 Y POM121L8P n/a
3 TRCN0000165320 GCGTGGTGTTTAGACACAGAT pLKO.1 4269 3UTR 100% 4.950 2.475 Y POM121L9P n/a
4 TRCN0000189167 GAAGTCAACATGCACGCAAGT pLKO.1 1772 3UTR 100% 4.050 2.025 Y POM121L8P n/a
5 TRCN0000203742 CAAGTCGTCTCAGGAAACTTT pLKO.1 1788 3UTR 100% 5.625 2.813 Y POM121L8P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15807 pDONR223 0% 5.1% None 1_3255del;3297G>A;3562_5935del n/a
2 ccsbBroad304_15807 pLX_304 0% 5.1% V5 1_3255del;3297G>A;3562_5935del n/a
3 TRCN0000471544 GACAGGCTGAGTGCTACTGTGTTA pLX_317 100% 5.1% V5 1_3255del;3297G>A;3562_5935del n/a
Download CSV