Transcript: Human NR_136268.1

Homo sapiens killer cell immunoglobulin like receptor, three Ig domains X1 (pseudogene) (KIR3DX1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-03-07
Taxon:
Homo sapiens (human)
Gene:
KIR3DX1 (90011)
Length:
3586
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136268.1
NBCI Gene record:
KIR3DX1 (90011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073450 CGGAGGATCCTAGTATCTACA pLKO.1 1388 3UTR 100% 4.950 6.930 N KIR3DX1 n/a
2 TRCN0000073449 GAGATCATATATGCCCAGTTA pLKO.1 1306 3UTR 100% 4.950 6.930 N KIR3DX1 n/a
3 TRCN0000073452 TCCTAGTATCTACATCACTGT pLKO.1 1395 3UTR 100% 2.640 3.696 N KIR3DX1 n/a
4 TRCN0000073451 GAAGAGACACAGGAGATCATA pLKO.1 1294 3UTR 100% 5.625 3.375 N KIR3DX1 n/a
5 TRCN0000073448 GCGTAGTATTCCGTGGTGTAT pLKO.1 2166 3UTR 100% 4.950 2.970 N KIR3DX1 n/a
6 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2012 3UTR 100% 4.950 2.475 Y SPC25 n/a
7 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 2019 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
8 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 2019 3UTR 100% 4.950 2.475 Y SPC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10280 pDONR223 100% 6.5% None 1_1236del;1471_3586del n/a
2 ccsbBroad304_10280 pLX_304 0% 6.5% V5 1_1236del;1471_3586del n/a
3 TRCN0000473032 GAAGCCGCTCACGTGTGTTCACCT pLX_317 100% 6.5% V5 1_1236del;1471_3586del n/a
Download CSV