Transcript: Human NR_136287.2

Homo sapiens cornichon family AMPA receptor auxiliary protein 3 (CNIH3), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CNIH3 (149111)
Length:
2426
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136287.2
NBCI Gene record:
CNIH3 (149111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144353 CGTGAGGACATCATCTTATTT pLKO.1 2137 3UTR 100% 15.000 21.000 N CNIH3 n/a
2 TRCN0000141289 CGACACTTTGAGTTACTGTCA pLKO.1 1120 3UTR 100% 2.640 3.696 N CNIH3 n/a
3 TRCN0000142525 GAATGCCGACACTTTGAGTTA pLKO.1 1114 3UTR 100% 4.950 3.465 N CNIH3 n/a
4 TRCN0000140461 GACCAGTGCAATCCTGTTCAT pLKO.1 985 3UTR 100% 4.950 3.465 N CNIH3 n/a
5 TRCN0000139082 CATCTGCTTCCTTCTGCGAAA pLKO.1 1035 3UTR 100% 4.050 2.835 N CNIH3 n/a
6 TRCN0000139169 CCCAAGACTCTTGTTGCCTTT pLKO.1 1702 3UTR 100% 4.050 2.835 N CNIH3 n/a
7 TRCN0000140562 GCCGACACTTTGAGTTACTGT pLKO.1 1118 3UTR 100% 3.000 1.800 N CNIH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05023 pDONR223 100% 14.4% None 1_858del;1054_1055ins113;1226_2426del n/a
2 ccsbBroad304_05023 pLX_304 0% 14.4% V5 1_858del;1054_1055ins113;1226_2426del n/a
3 TRCN0000478456 ACGAACGCAACATTGTAGAGCCGA pLX_317 62.6% 14.4% V5 1_858del;1054_1055ins113;1226_2426del n/a
Download CSV