Transcript: Human NR_136657.2

Homo sapiens synaptosome associated protein 47 (SNAP47), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SNAP47 (116841)
Length:
1863
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136657.2
NBCI Gene record:
SNAP47 (116841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427896 TGACCAGTTGTGAACCCTTTG pLKO_005 161 3UTR 100% 6.000 8.400 N SNAP47 n/a
2 TRCN0000168051 CAGAACAGAGTCTCACGTTAA pLKO.1 225 3UTR 100% 10.800 7.560 N SNAP47 n/a
3 TRCN0000446705 GGCAGATACCCAGGAACTAAC pLKO_005 657 3UTR 100% 10.800 7.560 N SNAP47 n/a
4 TRCN0000425876 AGACATGGCCTATCGTTTGAT pLKO_005 396 3UTR 100% 5.625 3.938 N SNAP47 n/a
5 TRCN0000069467 CCTTTGGGAAAGAAGGGATTT pLKO.1 176 3UTR 100% 10.800 6.480 N Clcn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14361 pDONR223 100% 32.7% None (many diffs) n/a
2 ccsbBroad304_14361 pLX_304 0% 32.7% V5 (many diffs) n/a
3 TRCN0000466953 TAAAGTCTGCATATGCCAAGCTGG pLX_317 56.7% 32.7% V5 (many diffs) n/a
4 ccsbBroadEn_09436 pDONR223 100% 31.1% None (many diffs) n/a
5 ccsbBroad304_09436 pLX_304 0% 31.1% V5 (many diffs) n/a
6 TRCN0000473598 ACTGGTGGTAAAGCCCCCCTTTGT pLX_317 16.3% 31.1% V5 (many diffs) n/a
Download CSV