Transcript: Human NR_136687.1

Homo sapiens nudix hydrolase 15 (NUDT15), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
NUDT15 (55270)
Length:
2928
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136687.1
NBCI Gene record:
NUDT15 (55270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050310 GACTCATGATTCAGAACCAAA pLKO.1 489 3UTR 100% 4.950 3.960 N NUDT15 n/a
2 TRCN0000289460 GACTCATGATTCAGAACCAAA pLKO_005 489 3UTR 100% 4.950 3.960 N NUDT15 n/a
3 TRCN0000050309 CAAGGCTATGATCCATTTAAA pLKO.1 610 3UTR 100% 15.000 10.500 N NUDT15 n/a
4 TRCN0000289456 CAAGGCTATGATCCATTTAAA pLKO_005 610 3UTR 100% 15.000 10.500 N NUDT15 n/a
5 TRCN0000176847 GAGAAGGAGAATTACCATTAT pLKO.1 436 3UTR 100% 13.200 9.240 N Nudt15 n/a
6 TRCN0000050312 CTGGTGGGATACAAAGGAAAT pLKO.1 646 3UTR 100% 10.800 7.560 N NUDT15 n/a
7 TRCN0000289394 CTGGTGGGATACAAAGGAAAT pLKO_005 646 3UTR 100% 10.800 7.560 N NUDT15 n/a
8 TRCN0000050308 CCTGGGAAGAATGTGCTCAAA pLKO.1 344 3UTR 100% 4.950 2.970 N NUDT15 n/a
9 TRCN0000289395 CCTGGGAAGAATGTGCTCAAA pLKO_005 344 3UTR 100% 4.950 2.970 N NUDT15 n/a
10 TRCN0000050311 GAAGCAGCTCTTCACCTGAAA pLKO.1 379 3UTR 100% 4.950 2.970 N NUDT15 n/a
11 TRCN0000289457 GAAGCAGCTCTTCACCTGAAA pLKO_005 379 3UTR 100% 4.950 2.970 N NUDT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08501 pDONR223 100% 16.7% None 1_180del;564A>G;673_2928del n/a
2 ccsbBroad304_08501 pLX_304 0% 16.7% V5 1_180del;564A>G;673_2928del n/a
3 TRCN0000479998 ATACATACCTCCAAATAACTCGAT pLX_317 73.9% 16.7% V5 1_180del;564A>G;673_2928del n/a
Download CSV