Transcript: Mouse NR_136931.1

Mus musculus ribosomal protein L39 pseudogene (LOC102634812), non-coding RNA.

Source:
NCBI, updated 2016-05-13
Taxon:
Mus musculus (mouse)
Gene:
LOC102634812 (102634812)
Length:
1833
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136931.1
NBCI Gene record:
LOC102634812 (102634812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_136931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424956 AGCGATTCCTGGCCAAGAAAC pLKO_005 1524 3UTR 100% 10.800 5.400 Y Rpl39 n/a
2 TRCN0000104114 CCTCAGTGGATCCGGATGAAA pLKO.1 1565 3UTR 100% 5.625 2.813 Y Rpl39 n/a
3 TRCN0000117635 CGATTCCTGGCCAAGAAACAA pLKO.1 1526 3UTR 100% 5.625 2.813 Y RPL39 n/a
4 TRCN0000333551 CGATTCCTGGCCAAGAAACAA pLKO_005 1526 3UTR 100% 5.625 2.813 Y RPL39 n/a
5 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 1311 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
6 TRCN0000427061 GATTCACACAATGGCAAGACT pLKO_005 1656 3UTR 100% 3.000 1.500 Y Rpl39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01440 pDONR223 95.9% 7.3% None (many diffs) n/a
2 ccsbBroad304_01440 pLX_304 0% 7.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV